Medical and Dental Consultantsí Association of Nigeria
Home - About us - Editorial board - Search - Ahead of print - Current issue - Archives - Submit article - Instructions - Subscribe - Advertise - Contacts - Login 
  Users Online: 1471   Home Print this page Email this page Small font sizeDefault font sizeIncrease font size
 

  Table of Contents 
ORIGINAL ARTICLE
Year : 2021  |  Volume : 24  |  Issue : 8  |  Page : 1150-1158

Individualized Supplement of Folic Acid Based on the Gene Polymorphisms of MTHER/MTRR Reduced the Incidence of Adverse Pregnancy Outcomes and Newborn Defects


1 Department of pharmacy, The People's Hospital of Chongqing Shuangqiao Economic & Technological Development Zone, China
2 The People's Hospital of Chongqing Shuangqiao Economic & Technological Development Zone, China

Date of Submission23-Jun-2020
Date of Acceptance10-Dec-2020
Date of Web Publication14-Aug-2021

Correspondence Address:
Dr. X Chen
Chongqing Shuangqiao Economic & Technological Development Zone, Chongqing, No. 6 Checheng Avenue, 400900
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/njcp.njcp_381_20

Rights and Permissions
   Abstract 


Background: The association between conventional folic acid supplement (FAS) in pregnancy and the occurrence of adverse pregnancy outcomes, newborn defects has been proven. However, recent researches have reported a weakened association. Based on the different maternal metabolism capability of folic acid, it's beneficial for clinicians to provide pregnant women with different doses of FAS, that's individualized FAS. Subjects and Methods: A total of 2,677 pregnant women in Dazu, Chongqing, China were recruited in this cohort study. 1,539 women volunteered to receive individualized FAS, in which FAS dose increased with the risk level of maternal genotype? specify MTHFR and MTRR (write in full then abbreviate bracket open and close) while 1,138 women received conventional FAS with unified FAS dose. Additionally, 1,964 pregnant women without FAS were retrospectively analyzed as the control. Finally, the incidence of adverse pregnancy outcomes and newborn defects were recorded. Results: Based on the genotype of MTHFR and MTRR, women were identified as five risk levels of folic acid metabolism. The distributions of genotype and risk levels were not significantly different between FAS-individualized supplement group and FAS-unified supplement group. However, compared with control or FAS-unified supplement group, the incidence of spontaneous abortion, prolonged pregnancy, premature labor, fetal macrosomia and congenital heart disease were significantly decreased in FAS-individualized supplement group. In subgroup analysis, individualized FAS significantly improved pregnancy outcomes for women between 20-40 years old and inhibited the occurrence of newborn defects in both women of the first gestation and women of ≥2 gestations. Conclusions: The application of individualized FAS based on gene polymorphisms was more effective in preventing adverse outcomes in the mother and child.

Keywords: Folic acid supplement, gene polymorphisms, newborn defects, pregnancy outcomes


How to cite this article:
Yang J, Luo G, Chen X. Individualized Supplement of Folic Acid Based on the Gene Polymorphisms of MTHER/MTRR Reduced the Incidence of Adverse Pregnancy Outcomes and Newborn Defects. Niger J Clin Pract 2021;24:1150-8

How to cite this URL:
Yang J, Luo G, Chen X. Individualized Supplement of Folic Acid Based on the Gene Polymorphisms of MTHER/MTRR Reduced the Incidence of Adverse Pregnancy Outcomes and Newborn Defects. Niger J Clin Pract [serial online] 2021 [cited 2022 Jan 25];24:1150-8. Available from: https://www.njcponline.com/text.asp?2021/24/8/1150/323853




   Introduction Top


Adverse pregnancy outcomes and newborn defects are one of the major factors that seriously affect the health of neonatal and also the quality of child's life.[1] Studies found the occurrence of adverse pregnancy outcomes and newborn defects associated with various genetic or environment factors, especially the lack of folic acid supplement (FAS).[2] Folic acid is a water-soluble B vitamin that can not be synthesized by our own body cells while folic acid participates in the process of DNA synthesis and methylation.[3] Therefore, during the pregnancy, extra FAS is crucial for the mother and child. As the lack of FAS has been proven to induce pregnancy complications, adverse pregnancy outcomes and newborn defects. Based on that, FAS has become the major concern of prenatal care, especially in the developing countries.[4],[5]

Previous studies reported the conventional FAS (400 μg/day) from three months prior to pregnancy to 12 weeks after pregnancy exerted significant preventive effects on newborns defects.[6] However, in recent years, studies have highlighted that even after conventional FAS, certain incidence of newborns defects still exist in pregnant women.[7] Several researches even found a weakened association between FAS and prevention of newborns defects.[7] In Evan's study, he also considered the FAS (400 μg/day) was not any more effective and it's time for clinicians to use current recommendation of 400-800 μg/day of FAS based on the maternal folate status.[8] As the different maternal metabolism capability of folic acid vary the required doses of FAS, it's beneficial to make individualized dose of FAS in mothers. This individualized FAS plan may better to prevent the incidence of adverse pregnancy outcomes and newborn defects for the mother and child. However, there is still paucity relevant reports addressing this concept of individualized FAS.

The maternal metabolism capability is mainly determined by genetic factors. Several genes have been reported to regulate the metabolism of folic acid, among which methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) are two crucial regulators.[9] MTHFR is the key enzyme in the folic acid and methionine-homocysteine metabolism cycle. It reduces 5, 10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, which is the main active form of folic acid in human bodies.[10] Additionally, the main function of MTRR is to reduce vitamin B12 to involve in methionine metabolism cycle.[11] The gene mutation of MTHFR and MTRR interferes with the activity of these enzymes and lead to the restricted capability of folic acid metabolism.[12] The common gene polymorphisms of MTHFR and MTRR are MTHFR 677CT, MTHFR 1298AC and MTRR 66AG. Thus, in pregnant women, the maternal metabolism capability of folic acid possibly associates with the genotype of MTHFR 677CT, MTHFR 1298AC and MTRR 66AG.

In this study, we conducted a large-sample cohort study to explore the genotype distribution and allelic frequencies of MTHFR 677CT, MTHFR 1298AC and MTRR 66AG in 2,677 pregnant women in Dazu, Chongqing, China. By comparing the incidence of adverse pregnancy outcomes and newborn defects between FAS-individualized supplement group and FAS-unified supplement group, this study aims to provided evidence that individualized FAS was more appropriate for women with different genotype and it may be better in preventing the occurrence of adverse pregnancy outcomes and newborn defects than conventional FAS method.


   Subjects and Methods Top


Enrolled pregnant women

In total 3,659 women of child-bearing age, who received reproductive consultation and were prepared for pregnancy at the Department of Obstetrics and Gynecology, Dazu Hospital from Jan 2013 to Feb 2018 were enrolled in the study. Enrolled women were prescribed to take FAS (400 μg/day) for three months before pregnancy. If a woman's genotype was detected as high risk of folic acid metabolism and they chose individualized FAS, women received increased FAS (800 μg/day) intake for three months before pregnancy. Inclusion criteria included: 1. no abnormal chromosome karyotypes were detected in the husband and wife; 2. no family genetic history, anatomical abnormalities of the reproductive system; 3. no family history of heart, liver, and kidney disease; 4. the husband's semen was normal by examinations; 5. the Eugenics test was negative; 6. no mycoplasma, chlamydia or HPV infections; 7. women were non-drinkers and non-smokers; 8 no exposure history of toxic chemical or element. Exclusion criteria included: 1. history of infection, radiation or drugs during pregnancy; 2. women received FSA for at least one and a half month before pregnancy; 3. no pregnancy complications were recorded during pregnancy, such as gestational diabetes mellitus, gestational hypertension, thrombocytopenia, etc; 4. incomplete data of women or mother and child information was not matched. Nine hundred and eighty-two (982) women were excluded from final analysis, due to severe pregnancy complications or incomplete data. Out of the remaining 2,677 women (FAS group), 1,539 volunteered to received individualized FAS while 1,138 women chose the conventional and unified FAS. Additionally, 1,964 pregnant women, admitted at Department of Obstetrics and Gynecology, Dazu Hospital from Jan 2010 to Mar 2015, who did not receive FAS before or during the whole period of pregnancy, were retrospectively analyzed to serve as the control (Non-FAS group). This study was approved by the Ethical Committee of Dazu Hospital (20130101). All the enrolled women signed the informed consents.

Genotype detection and risk rank of folic acid metabolism

All enrolled women in FAS group received genotype detection of MTHFR 677CT, MTHFR 1298AC and MTRR 66AG. Briefly, oral mucosa cells were collected with specialized swabs and genomic DNA was extracted with a column extraction kit (Qiagen). Gene polymorphisms of MTHFR 677CT, MTHFR 1298AC and MTRR 66AG were detected by Taqman-MGB (ABI). Specific sequences of Taqman-MGB probes were designed and synthesized by ABI: MTHFR 677CT (GAAAAGCTGCGTGATGATGAAATCG[G/A] CTCCCGCAGACACCTTCTCCTTCAA); MTHFR1298AC(AAGAACGAA GACTTCAAAGACACTT[G/T] CTTCACTGGTCAGCTCCTCCCCCCA); MTRR 66AG (AGGCAAAGGC CATCGCAGAAGAAAT[A/G] TGTGAGCAAGCTGTGGTACATGGAT). The solution reaction system was 10 μl, containing 20 ng of DNA template, 2×Taqman MasterMix 5 μl, 20×Taqman-MGB probe 0.5 μl, deionized water 3.5 μl. Then reactions were amplified and analyzed by PCR equipment (ABI7900). Based on the genotype, women were divided into five groups, unidentified risk (CC, AA, AA; CC, AC, AA), lower risk (CT, AA, AA; CT, AC, AA), moderate risk (TT, AA, AA; CC, AA, AG; CC, AC, AG; CC, AA, GG; CC, AC, GG), slightly high risk (CT, AA, AG; CT, AC, AG; CT, AA, GG; CT, AC, GG), high risk (TT, AA, AG; TT, AC, AG; CC, CC, AG; TT, AA, GG; CC, CC, GG)

Treatment methods

Based on whether a woman volunteered to received individualized FAS or unified FAS, women in FAS group were also divided as FAS-individualized supplement and FAS-unified supplement. After identifying their genotype, women in FAS-individualized supplement group received different doses of FAS during pregnancy, based on the risk level of folic acid metabolism [Figure 1]. Whereas women in FAS-unified supplement group received the same 400 μg/day FAS until the end of early pregnancy. During the late pregnancy, no extra FAS was absorbed in women of FAS-unified supplement group [Figure 1]. Patient compliance was monitored by a nurse staff by daily patient's self-reporting and checking.
Figure 1: Schematic diagram of FAS in FAS-individualized supplement group and FAS-unified supplement group during pregnancy, based on the risk level of folic acid metabolism. FAS, folic acid supplement

Click here to view


Evaluation of the characteristics and outcomes of pregnancy

The “maternal and child health records during pregnancy” questionnaire was used to evaluate the clinical characteristics of women. The questionnaire included the demography characteristics: age, BMI, degree of education, income of family; previous pregnancy history: number of pregnancies, number of gestations; previous history of adverse pregnancy outcome: abortion, premature labor, stillbirth, etc.

The pregnancy outcomes were recorded by G. L., who was unaware of woman's allocation in this study. During whole period of pregnancy and six months after discharge from hospital, adverse pregnancy outcome (spontaneous abortion, prolonged pregnancy, premature labor, low weight fetus, fetal macrosomia) and newborn defects (trisomy 21 syndrome, cleft lip and palate, congenital heart disease, spina bifida and other malformation) were recorded.

Statistical analysis

The statistical analysis was performed by SPSS software (version 19; US; 2015). The measurement data was calculated as frequency (percentage) and analyzed by χ2 test or Fisher exact test. The genotype frequencies and allelic frequencies were analyzed by Hardy–Weinberg genetic balance test. Two-sided P ≤ 0.05 was considered statistically significant.


   Results Top


Clinical characteristics of the participants

Clinical characteristics of the participants in FAS and Non-FAS group are shown in [Table 1]. Majority of the women were between 20 to 30 years of age and had BMI of 18-25. No apparent differences of distribution pattern were seen among groups.
Table 1: Clinical characteristics of patients

Click here to view


Genotype distribution of MTHFR and MTRR in women

Then we analyzed the distribution of MTHFR and MTRR gene polymorphisms in women. As shown in [Table 2], the genotype distribution of MTHFR 677CT, MTHFR 1298AC and MTRR 66AG were found to be Hardy–Weinberg balanced (All P > 0.05) both in FAS-individualized supplement group and FAS-unified supplement group. The allelic frequencies of MTHFR C in FAS-individualized supplement group and FAS-unified supplement group was 48.1%, 45.7%, respectively. The allelic frequencies of MTHFR A in FAS-individualized supplement group and FAS-unified supplement group was 81.4%, 79.5%, respectively. The allelic frequencies of MTRR A in FAS-individualized supplement group and FAS-unified supplement group was 75.1%, 76.6%, respectively. Additionally, when comparing the genotype distribution between two groups, no significant distribution differences of MTHFR 677CT (P = 0.07), MTHFR 1298AC (P = 0.11) and MTRR 66AG (P = 0.44) existed between FAS-individualized supplement group and FAS-unified supplement group.
Table 2: Distribution of MTHFR and MTRR gene polymorphisms in women

Click here to view


Risk rank of folic acid metabolism in women

Further we analyzed the risk rank of folic acid metabolism in women based on their genotype. Results showed the percentages of unidentified risk, lower risk, moderate risk, slightly high risk, high risk were similar between FAS-individualized supplement group and FAS-unified supplement group ([Table 3]. P = 0.44).
Table 3: Risk rank of folic acid metabolism in women

Click here to view


Pregnancy outcomes in women

To explore whether FAS improved the pregnancy outcomes in enrolled women, we further analyzed the incidence of abnormal frequency and newborn defects in groups. Results showed that compared to the Non-FAS group, FAS-individualized supplement group have significantly reduced incidence of abnormal frequency, including: spontaneous abortion (P < 0.01), prolonged pregnancy (P < 0.01), premature labor (P < 0.01), low weight fetus (P < 0.01), fetal macrosomia (P < 0.01), as well as newborn defect, including: malformation (P < 0.01), cleft lip and palate (P < 0.01), congenital heart disease (P < 0.01). Additionally, there were no trisomy 21 syndrome and spina bifida recorded in FAS-individualized supplement. Whereas 2 cases of trisomy 21 syndrome and 3 cases of spina bifida were observed in Non-FAS group. Differences were not statistically significant, due to the rare frequencies.

To investigate whether individualized supplement of FAS was better than unified supplement of FAS, we compared the incidence of abnormal frequency and newborn defects between two groups. As shown in [Table 4], results indicated that compared with FAS-unified supplement group, FAS-individualized supplement group have significantly reduced incidence of spontaneous abortion (P < 0.01), prolonged pregnancy (P = 0.03), premature labor (P < 0.01) and fetal macrosomia (P < 0.01), but not low weight fetus (P = 0.29). Additionally, the application of individualized FAS also significantly reduced the incidence of congenital heart disease (P < 0.01). Despite the number of cases of cleft lip and palate was also decreased with individualized FAS, the difference was not significant (P = 0.13). It indicates compared with unified supplement of FAS, the application of individualized FAS better reduced the incidence of spontaneous abortion, prolonged pregnancy, premature labor, fetal macrosomia and congenital heart disease, which also potentially affected the incidence of cleft lip and palate.
Table 4: Comparison of adverse pregnancy outcome and newborn defect among groups

Click here to view


Age-related and gestation-related differences of pregnancy outcomes

Further we analyzed the effects of individualized FAS on the pregnancy outcomes of women based on different ages or different number of gestations. As shown in [Table 5], compared with FAS-unified supplement group, significant reduction of incidence of adverse pregnancy outcome and newborn defects was detected in FAS-individualized supplement group when ages were between 20 to 40 (P < 0.05). However, no significant differences of pregnancy outcomes were detected in women <20 (P = 0.79) or >40 years old (P = 0.07). It indicates individualized FAS was more crucial and exerted more significant improvement for women between 20 to 40 years of age.
Table 5: Comparison of adverse pregnancy outcome and newborn defect in FAS groups based on age

Click here to view


Additionally, [Table 6] showed that compared with FAS-unified supplement group, significant reduction of incidence of adverse pregnancy outcome and newborn defects was detected in FAS-individualized supplement group both in women of first gestation or women of ≥2 gestations (P < 0.05). It indicates that the application of FAS-individualized supplement in women of first gestation or of ≥2 gestations will benefit from reduced incidence of adverse pregnancy outcome and newborn defects. However, due to low frequency of our included women, who underwent gestation for more than 2 times, further explorations were still needed to fully addressed this issue.
Table 6: Comparison of adverse pregnancy outcome and newborn defect in FAS groups based on number of gestations

Click here to view



   Discussion Top


Dietary folic acid deficiency is widespread in developing countries and approximately 25% of pregnant women in India have folic acid deficiency.[13] Folic acid deficiency may induce pregnancy complication (gestational diabetes mellitus, pregnancy-induced hypertension, etc), adverse pregnancy outcomes (spontaneous abortion, premature birth, etc) and also newborn defects (malformation, congenital heart disease, etc) in the mother and child. As the folic acid irreplaceably participate in the process of DNA synthesis and methylation, the lack of folic acid may inhibit or induce the abnormal development of newborns. Experiment from animals also proved those mice fetus, exposed to the antibodies of folate receptor, were reported to be teratogenic.[14] Additionally, low folate status induces hypercoagulability and venous thrombosis in maternal bodies. As a result, to reduce the incidence of adverse outcomes in the mother and child, FAS (400 μg/day) is recommended three months prior to pregnancy since 1991.[8],[15] In our study, similar findings were also obtained. Compared with Non-FAS group, the incidences of adverse pregnancy outcomes and newborn defects were all significantly decreased in FAS group. It strongly supports that extra FAS effectively compensate dietary folic acid deficiency.

However, recent studies found, despite FAS (400 μg/day) in women, some incidence of newborn defects still exist. The preventive effects of FAS on newborn defects is also weakening. This phenomenon may be due to the different folate metabolism capability of women. Specifically, the maternal metabolism capability of folic acid mainly associates with the gene polymorphisms of MTHFR and MTRR. The gene polymorphisms of MTHFR and MTRR also associates with the symptoms of folic acid deficiency. It's reported the maternal expression of MTHR 677TT is at high risk of congenital heart disease.[16] MTRR 66 A to G polymorphism also double the risk of trisomy 21 syndrome.[17] The underling mechanism of gene polymorphism and folic acid deficiency could be explained by Hamajima's and Murray's studies. They found individuals with MTHFR 677TT genotype had serum folate concentrations lower than those of the MTHFR 677CC or 677CT genotype. The enzyme activity was reduced by 30% in MTHFR 677CT genotype and even 60% in MTHFR 677TT genotype.[12] Individuals with the MTHFR 677TT genotype may need to consume more folic acid to maintain serum folate levels similar to those of the 677CC/677CT genotype.[18] Additionally, MTHFR 677TT genotype induce the accumulation of homocysteine and the reduction of methionine production, which led to the abnormal metabolism of folic acid and the symptoms of folic acid deficiency only in the conditions where folic acid intake was insufficient.[19] It indicates that folic acid deficiency can be counterbalanced by FAS, however, gene polymorphisms of MTHFR and MTRR determined the different dose of FAS. Unified dose FAS (400 μg/day) may not be sufficient for those individuals with high-risk genotype. Combing our study to exemplify, the women with moderate, slightly high, and high-risk level of folate metabolism accounted for more than half of the populations. It's time to make individualized FAS based on the risk level of genotype.

As suggested by Evan, individualized FAS (400-800 μg/day) may be more effective than unified FAS.[8] In our study, in FAS-individualized group, the prescribed dose of folic acid increased with the risk level of maternal genotype. In FAS-unified supplement group, women received unified dose of folic acid until the end of early pregnancy. Genotype frequency and allelic frequency analysis displayed the genotype distribution of MTHFR 677CT, MTHFR 1298AC and MTRR 66AG was not significant different between two groups. However, after different FAS, the incidence of spontaneous abortion, prolonged pregnancy, premature labor, fetal macrosomia and congenital heart disease were significantly decreased in FAS-individualized group. This result strongly suggests individualized FAS better prevent the occurrence of adverse pregnancy outcomes in the mother and child, compared with unified FAS. Additionally, despite incidence of cleft lip and palate was not significantly decreased after individualized FAS, the descend of incidence was also observed. Due to the rare frequencies, further study needed to enlarge the study population to clarify the effects of individualized FAS on the incidence of cleft lip and palate.

Results of our study also indicate that individualized FAS mainly benefit the women of 20-40 years old. It significantly decreased the incidence of adverse pregnancy and newborn defects, compared with unified FAS. However, these improvements were not that significant in women <20 or >40 years old. Individualized FAS also improved the pregnancy outcomes and newborn defects both in women of first gestation or women of ≥2 gestations. However, due to low frequency of the included women, who experienced gestation for more than 2 times, this hypothesis still needed to be proved in further explorations. Taken these results together, it provided instructions for clinical practice that individualized FAS was necessary and also urgent for pregnant women.

Similar study was conducted by Pan in 2015. He compared the effects of individualized FAS, based on gene polymorphisms of MTHFR and MTRR, and unified FAS on pregnancy complication.[20] Results also displayed that individualized FAS decreased the incidence of gestational diabetes mellitus, gestational hypertension, etc., As the pregnancy complication also affected the outcomes of newborn, we excluded women with these pregnancy complications from our study. Combining our results together, it provided strong evidences that individualized FAS was beneficial for clinicians to improve pregnancy complication, adverse pregnancy outcomes and newborn defect. Compared with conventional method, Nielsen highlighted that individualized supplement better changed the unhealthy life style of patients and increased their compliance, as individuals were found to understand individualized advice better and were more likely to follow dietary advice based on their personal situations.[21] Additionally, the detection of gene polymorphisms of MTHFR and MTRR also bring benefits for the long-term well-being of women. As reported, the gene polymorphisms of MTHFR and MTRR associates with the onset of numerous diseases, including type 2 diabetes mellitus,[22] mental disorder and even cancers.[23] The genetic test of MTHFR and MTRR will provide instructions for physicians to maintain the optimal folate status in women and prevent the onset of related diseases.

Despite the benefit of FAS has been proved,[24] it is not appropriate to use extreme high dose of folic acid. Studies ever tried to supply pregnant women with FAS (5 mg/day) to prevent the neural tube defect.[25] The prevention of neural tube defect was also observed, however, extreme high dose of folic acid inhibited serum vitamin B12 level and was reported to elevated the risk of Alzheimer's disease.[26] Studies also found that for most individuals, the red blood cell folate was increased in response to folic acid in a dose-response manner only up to an intake of 400 μg/day.[27] Thus, daily intake of folic acid was recommended to control between at 400-800 μg/day. FAS was not recommended at high dose for a long time, as it is not always safe.[28] Excessive application was also reported to induce breast cancer in mother[23] and decrease the seizure threshold in the child.[29] In this study, no significant adverse events were observed during pregnancy when individualized FAS was controlled between 400-800 μg/day. However, whether the dose of individualized FAS was safe, we will perform long-term follow up to clarify this remaining issue.


   Conclusion Top


In our study, 1,539 pregnant women received FAS-individualized supplement based on gene polymorphisms of MTHFR and MTRR. 1,138 pregnant women received FAS-unified supplement until the end of early pregnancy. Compared with FAS-unified supplement group, the incidence of adverse pregnancy outcomes and newborn defects was significantly decreased in FAS-individualized supplement group. Additionally, individualized FAS mainly benefit the women of 20-40 years old and inhibited the occurrence of newborn defects in both women of the first gestation and women of ≥2 gestations.

Declaration of patient consent

The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Dunlop AL, Mulle JG, Ferranti EP, Edwards S, Dunn AB, Corwin EJ. Maternal microbiome and pregnancy outcomes that impact infant health: A review. Adv Neonatal Care 2015;15:377-85.  Back to cited text no. 1
    
2.
Lewis DP, Van Dyke DC, Stumbo PJ, Berg MJ. Drug and environmental factors associated with adverse pregnancy outcomes. Part II: Improvement with folic acid. Ann Pharmacother 1998;32:947-61.  Back to cited text no. 2
    
3.
Qian YY, Huang XL, Liang H, Zhang ZF, Xu JH, Chen JP, et al. Effects of maternal folic acid supplementation on gene methylation and being small for gestational age. J Hum Nutr Diet 2016;29:643-51.  Back to cited text no. 3
    
4.
Rabiu TB, Tiamiyu LO, Awoyinka BS. Awareness of spina bifida and periconceptional use of folic acid among pregnant women in a developing economy. Childs Nerv Syst 2012;28:2115-9.  Back to cited text no. 4
    
5.
de Jong-Van den Berg LT, Hernandez-Diaz S, Werler MM, Louik C, Mitchell AA. Trends and predictors of folic acid awareness and periconceptional use in pregnant women. Am J Obstet Gynecol 2005;192:121-8.  Back to cited text no. 5
    
6.
Arias LD, Parra BE, Muñoz AM, Cárdenas DL, Duque TG, Manjarrés LM. Study exploring the effects of daily supplementation with 400 μg of folic acid on the nutritional status of folate in women of reproductive age. Birth Defects Res 2017;109:564-73.  Back to cited text no. 6
    
7.
Viswanathan M, Treiman KA, Kish-Doto J, Middleton JC, Coker-Schwimmer EJ, Nicholson WK. Folic acid supplementation for the prevention of neural tube defects: An updated evidence report and systematic review for the US preventive services task force. JAMA 2017;317:190-203.  Back to cited text no. 7
    
8.
Dolin CD, Deierlein AL, Evans MI. Folic acid supplementation to prevent recurrent neural tube defects: 4 milligrams is too much. Fetal Diagn Ther 2018;44:161-5.  Back to cited text no. 8
    
9.
Li WX, Dai SX, Zheng JJ, Liu JQ, Huang JF. Homocysteine metabolism gene polymorphisms (MTHFR C677T, MTHFR A1298C, MTR A2756G and MTRR A66G) jointly elevate the risk of folate deficiency. Nutrients 2015;7:6670-87.  Back to cited text no. 9
    
10.
Födinger M, Hörl WH, Sunder-Plassmann G. Molecular biology of 5,10-methylenetetrahydrofolate reductase. J Nephrol 2000;13:20-33.  Back to cited text no. 10
    
11.
Xu A, Wang W, Jiang X. The roles of MTRR and MTHFR gene polymorphisms in congenital heart diseases: A meta-analysis. Biosci Rep 2018;38:BSR20181160. doi: 10.1042/BSR20181160.  Back to cited text no. 11
    
12.
Hiraoka M, Kagawa Y. Genetic polymorphisms and folate status. Congenit Anom (Kyoto) 2017;57:142-9.  Back to cited text no. 12
    
13.
Black RE. Micronutrients in pregnancy. Br J Nutr 2001;85(Suppl 2):S193-7.  Back to cited text no. 13
    
14.
da Costa M, Sequeira JM, Rothenberg SP, Weedon J. Antibodies to folate receptors impair embryogenesis and fetal development in the rat. Birth Defects Res A Clin Mol Teratol 2003;67:837-47.  Back to cited text no. 14
    
15.
Lassi ZS, Salam RA, Haider BA, Bhutta ZA. Folic acid supplementation during pregnancy for maternal health and pregnancy outcomes. Cochrane Database Syst Rev 2013;CD006896. doi: 10.1002/14651858.CD006896.pub2.  Back to cited text no. 15
    
16.
Li Z, Jun Y, Zhong-Bao R, Jie L, Jian-Ming L. Association between MTHFR C677T polymorphism and congenital heart disease. A family-based meta-analysis. Herz 2015;40(Suppl 2):160-7.  Back to cited text no. 16
    
17.
Hobbs CA, Sherman SL, Yi P, Hopkins SE, Torfs CP, Hine RJ, et al. Polymorphisms in genes involved in folate metabolism as maternal risk factors for Down syndrome. Am J Hum Genet 2000;67:623-30.  Back to cited text no. 17
    
18.
Nishio K, Goto Y, Kondo T, Ito S, Ishida Y, Kawai S, et al. Serum folate and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism adjusted for folate intake. J Epidemiol 2008;18:125-31.  Back to cited text no. 18
    
19.
Wehby GL, Murray JC. Folic acid and orofacial clefts: A review of the evidence. Oral Dis 2010;16:11-9.  Back to cited text no. 19
    
20.
Li X, Jiang J, Xu M, Xu M, Yang Y, Lu W, et al. Individualized supplementation of folic acid according to polymorphisms of methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) reduced pregnant complications. Gynecol Obstet Invest 2015;79:107-12.  Back to cited text no. 20
    
21.
Nielsen DE, El-Sohemy A. A randomized trial of genetic information for personalized nutrition. Genes Nutr 2012;7:559-66.  Back to cited text no. 21
    
22.
Zhi X, Yang B, Fan S, Li Y, He M, Wang D, et al. Additive interaction of MTHFR C677T and MTRR A66G polymorphisms with being overweight/obesity on the risk of type 2 diabetes. Int J Environ Res Public Health 2016;13:1243.  Back to cited text no. 22
    
23.
Kim YI. Does a high folate intake increase the risk of breast cancer? Nutr Rev 2006;64:468-75.  Back to cited text no. 23
    
24.
De-Regil LM, Peña-Rosas JP, Fernández-Gaxiola AC, Rayco-Solon P. Effects and safety of periconceptional oral folate supplementation for preventing birth defects. Cochrane Database Syst Rev 2015;CD007950. doi: 10.1002/14651858.CD007950.pub3.  Back to cited text no. 24
    
25.
Group MVSR. Prevention of neural tube defects: Results of the Medical Research Council Vitamin Study. MRC Vitamin Study Research Group. Lancet 1991;338:131-7.  Back to cited text no. 25
    
26.
Robinson N, Grabowski P, Rehman I. Alzheimer's disease pathogenesis: Is there a role for folate? Mech Ageing Dev 2018;174:86-94.  Back to cited text no. 26
    
27.
Duffy ME, Hoey L, Hughes CF, Strain JJ, Rankin A, Souverein OW, et al. Biomarker responses to folic acid intervention in healthy adults: A meta-analysis of randomized controlled trials. Am J Clin Nutr 2014;99:96-106.  Back to cited text no. 27
    
28.
Selhub J, Rosenberg IH. Excessive folic acid intake and relation to adverse health outcome. Biochimie 2016;126:71-8.  Back to cited text no. 28
    
29.
Patel KR, Sobczyńska-Malefora A. The adverse effects of an excessive folic acid intake. Eur J Clin Nutr 2017;71:159-63.  Back to cited text no. 29
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6]



 

Top
  
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
   Introduction
   Subjects and Methods
   Results
   Discussion
   Conclusion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed358    
    Printed4    
    Emailed0    
    PDF Downloaded84    
    Comments [Add]    

Recommend this journal